Address

Author Topic: Bitter Taster PCR notes  (Read 3096 times)

da3v

  • Moderator
  • Full Member
  • *****
  • Posts: 114
    • View Profile
Bitter Taster PCR notes
« on: August 30, 2015, 07:33:40 PM »
Most lab members who have tried the PTC test paper have not been able to distinguish it from the control strips.  According to 23andme, I *should* be able to taste the difference, and could not, so our current theory is that the PTC treated paper samples had lost their potency and the few members who could distinguish a difference were most likely "supertasters".


We followed the protocol from https://docs.google.com/document/d/1CUBmOTPMUFRQsXzF5AOd-YmbE7G9qSZHNFIVlpekUNk , and while we did not get the expected PCR results, we did learn a few things along the way, and have some new questions to follow up on.


Here are some quick, sleep deprived notes for now.  Additional details will need to be filled in from the lab notebook.  Pictures are still uploading, I'll add a link when they are available.


We used Syber-safe green dye for visualization, and we did see some nice bands from the ladder DNA, but only saw faint, uniformly glowing tracks for the PCR samples.  We used TBE buffer instead of the TAE we have been using, and we used a higher concentration of agarose. (I believe it was 1gram to 400ml of buffer, but we should check the notes on that).  We severely underestimated the time for the 30 PCR cycles to finish, and would probably have not started this attempt had we known what we were getting into. (We multiplied out the times at each temperature, but did not include ramp times in between temperatures. Our original estimate was 1 hour 50 min, and it ended up taking closer to 3 hours.)


Things that might have gone wrong include, but are not limited to:
1) The water bath reached boiling during the NaOH lysing.  This might have damaged the sample DNA.
2) The primers were stored at 90F for a few days before they were moved to a freezer, and might have been damaged.
3) There were two containers of primer mix, with no distinguishing differences.  Based on quantity ordered, it seemed likely that they both contained the same mix, but it is possible that we needed 1/2 from each container to get "both ends".
4) This was our first real test of the openPCR.  It is possible that the temperatures reported were not accurate.
5) The protocol called for 25ul 2x master mix. We had 5x, and did math. Hopefully that wasn't a typo.


Followup:
1) Ask folks at the-odin for some troubleshooting help, starting with whether or not we needed to use both primer mixes.
2) Get pipettor and tips capable of handling .5ul reliably
3) Buy/build a better water bath/heating block.  Hot plate was stinky and difficult to keep within desired temperature range.
4) Test the temperature of the openPCR block
5) Look into fixing the lid for the proprietary PCR.
6) Verify volume/concentration of master mix specified in the protocol.
7) Find out if we lost some of the restriction enzyme in shipping. (There was very little in the tube)
 8) Make a note of how long things took, especially the PCR and gel run phases so we can budget time accordingly.
9) Confirm time we should allow for the restriction enzyme digest.







cosmicaug

  • FamiLAB Member
  • Newbie
  • *
  • Posts: 24
    • View Profile
Re: Bitter Taster PCR notes
« Reply #1 on: August 30, 2015, 11:27:28 PM »

Things that might have gone wrong include, but are not limited to:
1) The water bath reached boiling during the NaOH lysing.  This might have damaged the sample DNA.
2) The primers were stored at 90F for a few days before they were moved to a freezer, and might have been damaged.
3) There were two containers of primer mix, with no distinguishing differences.  Based on quantity ordered, it seemed likely that they both contained the same mix, but it is possible that we needed 1/2 from each container to get "both ends".
4) This was our first real test of the openPCR.  It is possible that the temperatures reported were not accurate.
5) The protocol called for 25ul 2x master mix. We had 5x, and did math. Hopefully that wasn't a typo.

Yes. Obviously, the primers are a quantity limiting reagent. You can only make as many copies of your sequence as you have pairs of primers. If I remember correctly (and I may not be remembering correctly) single stranded DNA is a lot more fragile than doubled stranded DNA. I don't specifically know how fragile primers are, that is, what their half life would be when stored well above room temperature, but, unless they are lyophilized, they really should remain frozen when not in use (and even lyophilized I am guessing that colder will still be a better choice than warmer).

2 could, thus, be a very good candidate for the PCR problem.

I had also thought that with PCR product that has not been cleaned up* we probably should have been able to see the primers in the gel. Remember, all primers are is very short pieces of DNA so they should travel in the gel like everything else. I thought that maybe we should have seen a smudge or a band beyond the 100 bp bad in our ladder but before our loading dye front (if our reagents followed the description at https://docs.google.com/document/d/1CUBmOTPMUFRQsXzF5AOd-YmbE7G9qSZHNFIVlpekUNk and did not use different primers, both of our primers are 18 base pairs long ?but single stranded). However, I found that this may not be so. The consensus at http://www.researchgate.net/post/Can_I_run_primers_alone_on_the_agarose_gel seems to be that you probably need to run a PAGE gel to see primers and that whether they can be seen will depend on the dye used. Maybe one might be able to see primers on 2% agarose but I have not seen any indication that SYBR Safe stains ssDNA so my guess is that my initial conjecture that we should have been able to see primers is likely way off the mark. Not seeing primers on the gel likely has zero diagnostic value.

Another possibility is that we did not have any primers for some other reason. Perhaps they layered upon thawing and since we did not vortex (or did you?) before using they remained layered and we happened to not pick up anything with the micropipette. I think this is very unlikely (specially when we take into account that we repeated the procedure three times --once for each cheek swab sample-- and none of the three attempts produced a PCR product).

Trying new primers would be a good thing. Testing the temperature of the thermocycler is probably also a good idea if it is relatively easy to do.

* You can get a kit to do this. However, this is probably something that we do not need to do and I am guessing that it probably would not affect our results.
« Last Edit: August 30, 2015, 11:47:47 PM by cosmicaug »

cosmicaug

  • FamiLAB Member
  • Newbie
  • *
  • Posts: 24
    • View Profile
Re: Bitter Taster PCR notes
« Reply #2 on: August 31, 2015, 01:41:37 AM »
9) Confirm time we should allow for the restriction enzyme digest.

I wasn't able to find it Saturday (Sunday?) but I just found a Chart at NEB that will answer all our questions regarding restriction digests:

https://www.neb.com/tools-and-resources/usage-guidelines/nebuffer-performance-chart-with-restriction-enzymes

For Fnu4HI it's 5-15 minutes at 37 degrees Celsius.

As an additional note, if you want to test it or you need a control for it it looks, from that table, like you should be able to use lambda virus DNA as a substrate.

cosmicaug

  • FamiLAB Member
  • Newbie
  • *
  • Posts: 24
    • View Profile
Re: Bitter Taster PCR notes
« Reply #3 on: August 31, 2015, 02:36:18 AM »
In response to my question regarding what we should have seen on the gel (if PCR had worked), here are my thoughts.

I am assuming that the primers we used are the ones described at the protocol we based our procedure which is found at https://docs.google.com/document/d/1CUBmOTPMUFRQsXzF5AOd-YmbE7G9qSZHNFIVlpekUNk. So I did find the page you found that described the sequence. It was an Open Wetware lesson. However, the primers used in the Open Wetware page are different than the ones used in the Google Docs protocol.

Alternatively, our gene can be found at http://www.ncbi.nlm.nih.gov/nuccore/20336518?report=fasta where we get:
Code: [Select]
>gi|20336518|gb|AF494231.1| Homo sapiens candidate taste receptor TAS2R38 gene, complete cds
ATGTTGACTCTAACTCGCATCCGCACTGTGTCCTATGAAGTCAGGAGTACATTTCTGTTCATTTCAGTCC
TGGAGTTTGCAGTGGGGTTTCTGACCAATGCCTTCGTTTTCTTGGTGAATTTTTGGGATGTAGTGAAGAG
GCAGGCACTGAGCAACAGTGATTGTGTGCTGCTGTGTCTCAGCATCAGCCGGCTTTTCCTGCATGGACTG
CTGTTCCTGAGTGCTATCCAGCTTACCCACTTCCAGAAGTTGAGTGAACCACTGAACCACAGCTACCAAG
CCATCATCATGCTATGGATGATTGCAAACCAAGCCAACCTCTGGCTTGCTGCCTGCCTCAGCCTGCTTTA
CTGCTCCAAGCTCATCCGTTTCTCTCACACCTTCCTGATCTGCTTGGCAAGCTGGGTCTCCAGGAAGATC
TCCCAGATGCTCCTGGGTATTATTCTTTGCTCCTGCATCTGCACTGTCCTCTGTGTTTGGTGCTTTTTTA
GCAGACCTCACTTCACAGTCACAACTGTGCTATTCATGAATAACAATACAAGGCTCAACTGGCAGAATAA
AGATCTCAATTTATTTTATTCCTTTCTCTTCTGCTATCTGTGGTCTGTGCCTCCTTTCCTATTGTTTCTG
GTTTCTTCTGGGATGCTGACTGTCTCCCTGGGAAGGCACATGAGGACAATGAAGGTCTATACCAGAAACT
CTCGTGACCCCAGCCTGGAGGCCCACATTAAAGCCCTCAAGTCTCTTGTCTCCTTTTTCTGCTTCTTTGT
GATATCATCCTGTGTTGCCTTCATCTCTGTGCCCCTACTGATTCTGTGGCGCGACAAAATAGGGGTGATG
GTTTGTGTTGGGATAATGGCAGCTTGTCCCTCTGGGCATGCAGCCATCCTGATCTCAGGCAATGCCAAGT
TGAGGAGAGCTGTGATGACCATTCTGCTCTGGGCTCAGAGCAGCCTGAAGGTAAGAGCCGACCACAAGGC
AGATTCCCGGACACTGTGCTGA

But the version with the polymorphisms found in tasters (the above sequence is for a non-taster) is different at three places (G145C, T785C, A886G*) according to the document describing the protocol that we used. Thus the "taster" version of the gene would be as follows:
Code: [Select]
>
ATGTTGACTCTAACTCGCATCCGCACTGTGTCCTATGAAGTCAGGAGTACATTTCTGTTCATTTCAGTCC
TGGAGTTTGCAGTGGGGTTTCTGACCAATGCCTTCGTTTTCTTGGTGAATTTTTGGGATGTAGTGAAGAG
GCAGCCACTGAGCAACAGTGATTGTGTGCTGCTGTGTCTCAGCATCAGCCGGCTTTTCCTGCATGGACTG
CTGTTCCTGAGTGCTATCCAGCTTACCCACTTCCAGAAGTTGAGTGAACCACTGAACCACAGCTACCAAG
CCATCATCATGCTATGGATGATTGCAAACCAAGCCAACCTCTGGCTTGCTGCCTGCCTCAGCCTGCTTTA
CTGCTCCAAGCTCATCCGTTTCTCTCACACCTTCCTGATCTGCTTGGCAAGCTGGGTCTCCAGGAAGATC
TCCCAGATGCTCCTGGGTATTATTCTTTGCTCCTGCATCTGCACTGTCCTCTGTGTTTGGTGCTTTTTTA
GCAGACCTCACTTCACAGTCACAACTGTGCTATTCATGAATAACAATACAAGGCTCAACTGGCAGAATAA
AGATCTCAATTTATTTTATTCCTTTCTCTTCTGCTATCTGTGGTCTGTGCCTCCTTTCCTATTGTTTCTG
GTTTCTTCTGGGATGCTGACTGTCTCCCTGGGAAGGCACATGAGGACAATGAAGGTCTATACCAGAAACT
CTCGTGACCCCAGCCTGGAGGCCCACATTAAAGCCCTCAAGTCTCTTGTCTCCTTTTTCTGCTTCTTTGT
GATATCATCCTGTGCTGCCTTCATCTCTGTGCCCCTACTGATTCTGTGGCGCGACAAAATAGGGGTGATG
GTTTGTGTTGGGATAATGGCAGCTTGTCCCTCTGGGCATGCAGCCGTCCTGATCTCAGGCAATGCCAAGT
TGAGGAGAGCTGTGATGACCATTCTGCTCTGGGCTCAGAGCAGCCTGAAGGTAAGAGCCGACCACAAGGC
AGATTCCCGGACACTGTGCTGA

This is shown in the Open Wetware lesson as follows:




The underlined bases represent the restriction site for Fnu4HI which is:


The primers in the Google Docs document have the following two sequences:

Fwd PTC gene
ctcagcctgctttactgc
Rev PTC gene
cattatcccaacacaaac

So if we really are using those primers our experiment looks like this:


Do note that the reverse primer (shown in pink) is represented in above graphic as its reversed complement.

This gives us two segments 449 bp long and 73 bp long respectively:
Code: [Select]
CTCAGCCTGCTTTACTGCTCCAAGCTCATCCGTTTCTCTCACACCTTCCTGATCTGCTTGGCAAGCTGGG
TCTCCAGGAAGATCTCCCAGATGCTCCTGGGTATTATTCTTTGCTCCTGCATCTGCACTGTCCTCTGTGT
TTGGTGCTTTTTTAGCAGACCTCACTTCACAGTCACAACTGTGCTATTCATGAATAACAATACAAGGCTC
AACTGGCAGAATAAAGATCTCAATTTATTTTATTCCTTTCTCTTCTGCTATCTGTGGTCTGTGCCTCCTT
TCCTATTGTTTCTGGTTTCTTCTGGGATGCTGACTGTCTCCCTGGGAAGGCACATGAGGACAATGAAGGT
CTATACCAGAAACTCTCGTGACCCCAGCCTGGAGGCCCACATTAAAGCCCTCAAGTCTCTTGTCTCCTTT
TTCTGCTTCTTTGTGATATCATCCTGTGC

and

Code: [Select]
TGCCTTCATCTCTGTGCCCCTACTGATTCTGTGGCGCGACAAAATAGGGGTGATGGTTTGTGTTGGGATA
ATG


So, if I have done this right, the answer should be that a 552 bp band in the non taster will turn into two bands of 449 bp and 73 bp in the taster.




* This is a commonly used notation for describing single point mutations. One uses the single letter notation for an amino acid or nucleotide (depending on whether you are describing an amino acid sequence or a nucleotide sequence) at a particular position, follows it by the position number (not always the number one might think --but I digress) and ends it with the single letter notation for the mutated version. By the way, I am using the word "mutant" to mean a deviation from a reference version. It is not intended to mean that it is better or worse than the wild type.

da3v

  • Moderator
  • Full Member
  • *****
  • Posts: 114
    • View Profile
Re: Bitter Taster PCR notes
« Reply #4 on: August 31, 2015, 02:30:31 PM »
I just did some sanity testing, and the temperature of the block seems to be 2-4 degrees below the displayed temperature.  I disabled the lid of the bio-rad PCR, and checked the block temperature using the hand-held IR thermometer, then did the same for the openPCR.


Bio-rad:
display  measured
95.0     96.0
72.0     72.1
55.0     54.8


openPCR
display measured
95        91.3
55        52.9
72        68.9


The aluminum block of the bio-rad has a non-reflective finish, while the openPCR block is shiny.  I darkened a strip on the openPCR block with a sharpie to cut down on reflection, but don't know if sharpie is IR visible or transparent.  It is possible that part of the difference in the reading is due to reflectivity interfering with the thermometer, but I suspect that the block is still a bit cooler than we want it to be.


I don't think a slightly lower temperature would necessarily interfere with the annealing or extending phases, but it could very well interfere with denaturing.


According to http://www.bio-rad.com/en-us/applications-technologies/pcr-troubleshooting , "no bands" can be due to denaturing temp too low.  (They also mention degradation if denaturing time is too long, and I am wondering if that initial 10 min at 95 will lead to problems, once we actually start reaching 95, as well.)


I'll still ping the-oden for advice, and order some fresh primers, but I might try another PCR run tomorrow before/during open-house.












da3v

  • Moderator
  • Full Member
  • *****
  • Posts: 114
    • View Profile
Re: Bitter Taster PCR notes
« Reply #5 on: August 31, 2015, 11:46:37 PM »
cosmicaug's highlighted gene visualizations and analysis in reply #3 made this a lot more clear for me. Thanks!

I heard back from the-odin, some blanks are starting to fill in:

1) Ask folks at the-odin for some troubleshooting help, starting with whether or not we needed to use both primer mixes.

    Both tubes contained the same primer mix, so we were okay there.

2) Get pipettor and tips capable of handling .5ul reliably
     (I still need to do this)

3) Buy/build a better water bath/heating block.  Hot plate was stinky and difficult to keep within desired temperature range.

     (I have a sous vide kit that would be great for this)


4) Test the temperature of the openPCR block


   Initial test looks like it was low


5) Look into fixing the lid for the proprietary PCR.


   Still a goal, but I picked up some mineral oil for now.


6) Verify volume/concentration of master mix specified in the protocol.


    We did the right thing, and the protocol online has been updated. Good catch cosmicaug!


7) Find out if we lost some of the restriction enzyme in shipping. (There was very little in the tube)


    I will order a fresh kit once we get the PCR phase nailed down.


 8) Make a note of how long things took, especially the PCR and gel run phases so we can budget time accordingly.


    (Still very much on the todo list)


9) Confirm time we should allow for the restriction enzyme digest.

     For some reason, the forums interface mangled my original reply.  Let's go with the values cosmicaug got from the NEB site.


Some general advice from the-odin:

The most common error is not getting access to the DNA in the cheek cells. This can happen because they were not heated enough(so the don't cells burst) or there is a pipetting error.


I would also make sure you are careful with pipette errors as this can lead to no bands showing up."
« Last Edit: August 31, 2015, 11:54:16 PM by da3v »

da3v

  • Moderator
  • Full Member
  • *****
  • Posts: 114
    • View Profile
Re: Bitter Taster PCR notes
« Reply #6 on: September 02, 2015, 02:41:10 PM »
We started fresh last night, but were multitasking with our open-house and Transcriptic meetup at BioCurious.


We got swabs from 4 people, heated 2 at approx 80-85c for 20 min, 1 at 80-85c for 10min, and one at 80-85c for 20min followed by a ramp up to 90-95c for 10 min.


PCR samples were prepared in tubes for both Bio-Rad and openPCR , and we refrigerated everything with the intent to run PCR on Thurs.


Things we learned:
1) Whatever a "real" water bath costs, it is worth it. (I've ordered one and should have it by Saturday)


2) Two critical steps require pipetting amounts smaller than the marked range for smallest pipette (1.0uL (primer mix) and 0.5uL (restriction enzyme, which was not done last night, but will still be difficult when we get to that point))


Would we be better off separating out a more easily measured quantity (4uL of primer, for example) and then diluting it with 4uL distilled water, and then dividing out 2uL of that mixture to each participant's tube, subtracting from the distilled water added later? -possibly better pipetting accuracy, but chance of poor mixing, and/or primers interacting with impurities in our non-DI, not-yet-buffered water.


3) We should probably target quick, visual demo-able stuff for open house, and not try to get "new" things done.


4) This particular protocol is a long process. We need to find a "safe" stopping point so we can break it up into smaller chunks, and how long things can be kept in that state between classes.  Having better timing notes would help us have a better sense of when we need to get started in order to finish before stupid-o'clock in the morning.


5) Pre-preparing tubes of mix for the lab might speed things up, and increase odds of success (especially if done by a more responsible adult than myself) but at some point we would cross the "Betty Crocker threshold" and not meet a minimum "hands on" learning experience.  This will probably require a few test classes to get a handle on.





cosmicaug

  • FamiLAB Member
  • Newbie
  • *
  • Posts: 24
    • View Profile
Re: Bitter Taster PCR notes
« Reply #7 on: September 02, 2015, 03:44:58 PM »
2) Two critical steps require pipetting amounts smaller than the marked range for smallest pipette (1.0uL (primer mix) and 0.5uL (restriction enzyme, which was not done last night, but will still be difficult when we get to that point))


Would we be better off separating out a more easily measured quantity (4uL of primer, for example) and then diluting it with 4uL distilled water, and then dividing out 2uL of that mixture to each participant's tube, subtracting from the distilled water added later?

Sounds like a possibly good idea.

2) -possibly better pipetting accuracy, but chance of poor mixing, and/or primers interacting with impurities in our non-DI, not-yet-buffered water.

I'd worry more about the water not being pure enough* (I'm not sure if we should worry about it not being nuclease free). As I remember it, standard procedure for re-hydrating primers is distilled water or TE buffer. Either one is OK. It doesn't seem to be a requirement that the primer solution be buffered.


Edited to add note below:
* But with the normal procedure we still add the water in another step so this is really not changing anything (unless there was something in the PCR master mix that might protect the DNA, like EDTA, making the order in which we add the ingredients matter but I don't think that is the case).
« Last Edit: September 02, 2015, 04:09:26 PM by cosmicaug »

melu

  • Newbie
  • *
  • Posts: 2
    • View Profile
Re: Bitter Taster PCR notes
« Reply #8 on: September 02, 2015, 11:16:23 PM »
During which step is the water bath used?  Is there any way to take advantage of the PCR as a heating element?




melu

  • Newbie
  • *
  • Posts: 2
    • View Profile
Re: Bitter Taster PCR notes
« Reply #9 on: September 02, 2015, 11:40:16 PM »
Here's an older review article on the perception of PTC that was interesting: http://www.ncbi.nlm.nih.gov/pmc/articles/PMC3349222/


cosmicaug

  • FamiLAB Member
  • Newbie
  • *
  • Posts: 24
    • View Profile
Re: Bitter Taster PCR notes
« Reply #10 on: September 03, 2015, 01:05:03 AM »
During which step is the water bath used?  Is there any way to take advantage of the PCR as a heating element?
Good idea! The regular PCR tubes that fit in the OpenPCR are almost certainly too small for the volume required but the PTC 100 might be able to accept regular microcentrifuge tubes. That could work.

If it works, you could even use it as a heating block for other things (such as transformations). However, I think it would be better to eventually have a dedicated heating block using an actual heating element rather than a Peltier (since I would assume these may have a limited lifespan???) and just do this until the other gets done.

cosmicaug

  • FamiLAB Member
  • Newbie
  • *
  • Posts: 24
    • View Profile
Re: Bitter Taster PCR notes
« Reply #11 on: September 08, 2015, 02:11:45 AM »
cosmicaug's highlighted gene visualizations and analysis in reply #3 made this a lot more clear for me. Thanks!

Following the aphorism about a picture being worth a thousand words, here is how ApE renders it:



Of course, only the relative positions are represented. The large or small end of the gels may be more or less compressed depending on agarose gel concentration. Also, note that my ladder selection was the NEB 100bp ladder. I thought I would have to manually enter my own ladder settings but then I found out that the The Odin 100bp ladder is the same thing as the NEB 100bp ladder (the sizes and amounts are an exact match). I'm not sure why the website doesn't mention that.

Note that ApE represents the 75bp  band as much lighter than the others (I made it even worse by setting the background transparent --which I should not have done). I was actually surprised by that because I was unaware that ApE would make any sort of effort to crudely represent intensity. It does make sense because, even though the stoichiometry of the 447 bp band and the 75 bp band is strictly 1:1, fluorescence is actually proportional to the total mass and in the 75 bp band there should be less than 1/5 the mass of what is in the447 bp band.

I really should have used ApE to look at this earlier instead of basically doing it by hand using LibreOffice but I did not think of it.

And yes, if folk don't know about ApE it might be good to look into it. It would be better if it were open source but it's a pretty good little program as it is.

So the basics are that FASTA is a file format for both proteins and DNA with very simple requirements. It needs a '>' character optionally followed by a description that uses a defined format, followed by a new line character (I'm not sure if that means the newline character, the carriage return or both --probably whatever is standard in unix systems) followed by a sequence expressed with one letter codes (it is recommended that lines are less than 80 characters wide). ApE will read this.

ApE will also read other formats which include metadata about the sequence features: basically what each subsequence is. This is useful to have. Whenever you get a plasmid sequence get anything but the FASTA sequence since you will want the annotation (you could put it in by hand using ApE but that would be silly). For instance, if I were interested in pUC9, I would go to https://www.addgene.org/browse/sequence_vdb/4520/ , click on the sequence tab, click on the GenBank link, select all and copy to the clipboard, paste into a plain text editor, save the file with a .gb extension (something like "pUC9.gb") and open in ApE.

It would also be very good to learn about the Genome Compiler. I think I heard about it through The Glowing Plant Project but I had not downloaded it until right now. I intend to explore at some later date.

cosmicaug

  • FamiLAB Member
  • Newbie
  • *
  • Posts: 24
    • View Profile
Re: Bitter Taster PCR notes
« Reply #12 on: September 17, 2015, 07:16:51 PM »
I'm hoping for a forthcoming report of the PCR working soon.

 :)


da3v

  • Moderator
  • Full Member
  • *****
  • Posts: 114
    • View Profile
Re: Bitter Taster PCR notes
« Reply #13 on: September 19, 2015, 07:30:30 PM »
We have fresh primers from Carolina, and I will give them a shot soon. (Still recovering from Maker Faire Orlando).

cosmicaug

  • FamiLAB Member
  • Newbie
  • *
  • Posts: 24
    • View Profile
Re: Bitter Taster PCR notes
« Reply #14 on: November 01, 2015, 05:18:56 AM »
Dave was thinking that we only ordered the Carolina primers and that therefore we did not have the restriction enzyme called for in the Carolina lab exercise. I thought that it was possible that the enzyme we used for the The Odin protocol would also work if used with the Carolina amplicons but there's no way to know until we actually look at what we are doing.

First observation is that, assuming the sequence I have for the gene is correct, the next to last nucleotide of our forward primer is not a match. The corresponding nucleotide in the gene is an adenine and it gets turned into a guanine in the primer. I am assuming that this is correct because it matches the sequence shown in the OpenWetware lesson. The forward primer is rather long so just missing one nucleotide match would not prevent it from annealing to that site (which we can confirm since our gel showed that PCR worked!). When you see a changed nucleotide sequence in a primer, that sequence will become part of the amplicon. This can be done on purpose to introduce a mutation in your amplicon (such as if you wish to create or destroy a recognition site or even if you want to add nucleotides at the end).

I have chosen to use a sequence to reflect that change in all of my ApE examples including the original sequence examples (even though it does not reflect the true sequence at that single nucleotide). The examples show the locations of the primers and the recognition sites for the Fnu4HI restriction enzyme which cuts as follows:



Here's the original full sequence for the taster:


 



Here's the original full sequence for the non taster:


 



The disappearance of the recognition site resulting from T785C (as per the second mutation mentioned in the Open Wetware lesson that I refer to in my third post) is what the The Odin primers were intended to capture and you can see that our Carolina primer based amplicons no longer capture that site. So we are done here, right?

Not so fast! Take a look at G145C and how it destroys another Fnu4HI recognition site. I can tell you I was very surprised to see 2 of the 3 mutations impacting Fnu4HI recognition sites! That was totally unexpected!

So let's get rid of the extraneous parts of the sequence and focus only on the amplicons.

Here's the amplicon for the taster sequence:

 

 


Here's the amplicon for the non-taster sequence:


 


We can clearly see that with a Fnu4HI digestion we should expect to find three fragments in our electrophoresis gel for our taster genetic sequence and only two for out non-taster genetic sequence.

If we choose to "run" our gel in Ape we get the following:


So our taster lane produces a 40bp band and a 27 bp band whereas the non taster produces a 67bp band. In theory, we can see this.

The question is, can we see this in a real gel?

In the Carolina protocol, they seem to be able to see a 44 bp band so a 67 bp band should also be visible (specially if PCR works as well as it did for us!). I am still not 100% convinced that we will be able to see it because it also has to look different from a 40 bp and 27 bp bands. It is possible that these two bands will be too close on the gel to be able to be told apart from the 67bp band. Certainly we will need to ensure that we cast a more concentrated agarose gel (definitely nothing under 1% and probably closer to 2%).

The only way to be able to tell will be by running it.